GBK-Rab4AS22NΔCGC
(Plasmid #49832)

• Purpose: expresses GAL4BD-Rab4AS22NΔCGC in yeast cells
• Depositing Lab: Marci Scidmore
• Publication: Scidmore Lab GAL4BD plasmids (unpublished)

Backbone

• Vector backbone: GBK-T7
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7300
• Total vector size (bp): 7900
• Vector type: Yeast Expression
• Selectable markers: Neomycin (select with G418), TRP1

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rab4A
• Species: H. sapiens (human)
• Insert Size (bp): 600
• Mutation: Starts at Met6; Serine 22 to Asparagine; deleted cysteine 216, glycine 217, cysteine 218
• GenBank ID: AF498934
• Entrez Gene: RAB4A (a.k.a. HRES-1, HRES-1/RAB4, HRES1, RAB4)
• Promoter: ADHI
• Tags / Fusion Proteins:
  • Gal4 Binding Domain (N terminal on insert)
  • Myc

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI/SalI (destroyed during cloning)
• 5′ sequencing primer: T7 (TAATACGACTCACTATAGGG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Rab4A cDNA derived from pCDNA3.1+Rab4A purchased from Missouri S&T cDNA Resource Center The discrepancies between the QC and full sequence should not affect plasmid function.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry