pCDNA-HA-Rab35Q67L
(Plasmid
#49880)
-
Purposeexpresses HA-Rab35Q67L in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDNA3.1+
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6028
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab35
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
Mutationglutamine 67 to leucine
-
GenBank IDAF498960
-
Entrez GeneRAB35 (a.k.a. H-ray, RAB1C, RAY)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3X-HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site kpn (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer T7 Fwd (TAATACGACTCACTATAGGG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byderived from pCDNA3.1+HA-Rab35 (purchased from Missouri S&T cDNA Resource Center)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA-HA-Rab35Q67L was a gift from Marci Scidmore (Addgene plasmid # 49880)