pCVL iRFP-T2A-Trex2
(Plasmid
#50418)
-
PurposeCoexpresses Trex2 and iRFP in mammalian cells.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCVL.Active/Repressed TLR (Sce)
-
Modifications to backboneReplaced the sequence between the BamHI and NsiI sites of the vector.
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameiRFP
-
Insert Size (bp)948
- Promoter SFFV
-
Tag
/ Fusion Protein
- T2A (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer GAGCTCTATAAAAGAGCTCAC
- 3′ sequencing primer TGCCCCACCATTTTGTTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTrex2
- Promoter SFFV
-
Tag
/ Fusion Protein
- T2A (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer GAGCTCTATAAAAGAGCTCAC
- 3′ sequencing primer TGCCCCACCATTTTGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are some discrepancies between Addgene's quality control sequence and the depositor sequence. These differences should not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCVL iRFP-T2A-Trex2 was a gift from Andrew Scharenberg (Addgene plasmid # 50418 ; http://n2t.net/addgene:50418 ; RRID:Addgene_50418)