Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCVL iRFP-T2A-Trex2
(Plasmid #50418)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50418 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCVL.Active/Repressed TLR (Sce)
  • Modifications to backbone
    Replaced the sequence between the BamHI and NsiI sites of the vector.
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    iRFP
  • Insert Size (bp)
    948
  • Promoter SFFV
  • Tag / Fusion Protein
    • T2A (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer GAGCTCTATAAAAGAGCTCAC
  • 3′ sequencing primer TGCCCCACCATTTTGTTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Trex2
  • Promoter SFFV
  • Tag / Fusion Protein
    • T2A (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer GAGCTCTATAAAAGAGCTCAC
  • 3′ sequencing primer TGCCCCACCATTTTGTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are some discrepancies between Addgene's quality control sequence and the depositor sequence. These differences should not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCVL iRFP-T2A-Trex2 was a gift from Andrew Scharenberg (Addgene plasmid # 50418 ; http://n2t.net/addgene:50418 ; RRID:Addgene_50418)