pSLIK-NFLAG-hFUS
(Plasmid #50487)

• Purpose: Produces lentivirus expressing human FUS with FLAG tag at its N-terminus by co-transfection with psPAX2 and pMD2G
• Depositing Lab: Zissimos Mourelatos
• Publication: Nakaya et al RNA. 2013 Apr;19(4):498-509. doi: 10.1261/rna.037804.112. Epub 2013 Feb 6.

Backbone

• Vector backbone: pSLIK-neo
• Backbone manufacturer: Iain Fraser(Addgene plasmid #25735)
• Backbone size w/o insert (bp): 13286
• Total vector size (bp): 14200
• Vector type: Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FUS
• Alt name: fused in sarcoma
• Alt name: TLS
• Alt name: hnRNP P2
• Species: H. sapiens (human)
• Insert Size (bp): 1680
• GenBank ID: NM_004960.3
• Entrez Gene: FUS (a.k.a. ALS6, ETM4, FUS1, HNRNPP2, POMP75, TLS, altFUS)
• Promoter: TRE
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TGGAGACGCCATCCACGCTG
• 3′ sequencing primer: CCATCTTTATGGCTCGAGATG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry