FN 221
(Plasmid
#50498)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSETC'
-
Backbone manufacturerInvitrogen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefibronectin
-
Alt nameFN1
-
Alt nameFN type III repeats 6-10, C to A mutation in III-7, KGE in III-10
-
SpeciesH. sapiens (human)
-
Mutationrepeats 6-10, R1524K, D1526E, C1232A
-
Entrez GeneFN1 (a.k.a. CIG, ED-B, FINC, FN, FNZ, GFND, GFND2, LETS, MSF, SMDCF)
- Promoter T7
-
Tag
/ Fusion Protein
- 6X-His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer RSET FW (AATACGACTCACTATAGGGAG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FN 221 was a gift from Kenneth Yamada (Addgene plasmid # 50498 ; http://n2t.net/addgene:50498 ; RRID:Addgene_50498)