Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGFP-PTEN
(Plasmid #50519)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50519 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGZ21dxZ
  • Backbone manufacturer
    Yamada Lab, Tamura et al., Science 280: 1614-7 (1998)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PTEN
  • Alt name
    MMAC1
  • Alt name
    tumor suppressor, phosphatase
  • Species
    H. sapiens (human)
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GFP FW (AAAGACCCCAACGAGAAGCG)
  • 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP-PTEN was a gift from Kenneth Yamada (Addgene plasmid # 50519 ; http://n2t.net/addgene:50519 ; RRID:Addgene_50519)
  • For your References section:

    Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM. Science. 1998 Jun 5;280(5369):1614-7. 10.1126/science.280.5369.1614 PubMed 9616126