pRK VSV Cortactin
(Plasmid
#50727)
-
Purposemammalian expression of VSV-tagged Cortactin
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRK VSV
-
Backbone manufacturerYamada Lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCortactin
-
Alt nameEMS1
-
Alt nameCTTN
-
SpeciesH. sapiens (human)
-
Entrez GeneCTTN (a.k.a. EMS1)
- Promoter CMV
-
Tag
/ Fusion Protein
- 2xVSV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer pRK KZ FW (TAGAATAACATCCACTTTGCC)
- 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA was obtained from Invitrogen.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
12AA missing in actin -binding domain was restored by site sirected mutagenesis.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK VSV Cortactin was a gift from Kenneth Yamada (Addgene plasmid # 50727 ; http://n2t.net/addgene:50727 ; RRID:Addgene_50727)