pSLIK-NFLAG-hEWSR1WT-CMyc
(Plasmid
#50733)
-
PurposeProduces lentivirus expressing human EWSR1 wild type with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2G
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50733 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSLIK-neo
-
Backbone manufacturerIain Fraser(Addgene plasmid #25735)
- Backbone size w/o insert (bp) 13286
- Total vector size (bp) 14600
-
Modifications to backbonehEWSR1 was cloned into pEN_Tmcs vector at SpeI/NotI sites. The SpeI site was blunt-ended for use. Using LR-recombination, the insert was recombinated into pSLIK-neo vector along with TRE promoter.
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEWSR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2032
-
GenBank IDNM_001163285.1 NM_001163285.1
-
Entrez GeneEWSR1 (a.k.a. EWS, EWS-FLI1, bK984G1.4)
- Promoter TRE
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- Myc (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGGAGACGCCATCCACGCTG
- 3′ sequencing primer CCATCTTTATGGCTCGAGATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK-NFLAG-hEWSR1WT-CMyc was a gift from Zissimos Mourelatos (Addgene plasmid # 50733 ; http://n2t.net/addgene:50733 ; RRID:Addgene_50733) -
For your References section:
Evaluating the role of the FUS/TLS-related gene EWSR1 in amyotrophic lateral sclerosis. Couthouis J, Hart MP, Erion R, King OD, Diaz Z, Nakaya T, Ibrahim F, Kim HJ, Mojsilovic-Petrovic J, Panossian S, Kim CE, Frackelton EC, Solski JA, Williams KL, Clay-Falcone D, Elman L, McCluskey L, Greene R, Hakonarson H, Kalb RG, Lee VM, Trojanowski JQ, Nicholson GA, Blair IP, Bonini NM, Van Deerlin VM, Mourelatos Z, Shorter J, Gitler AD. Hum Mol Genet. 2012 Jul 1;21(13):2899-911. doi: 10.1093/hmg/dds116. Epub 2012 Mar 27. 10.1093/hmg/dds116 PubMed 22454397