Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTRE-tdTomato
(Plasmid #50798)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50798 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUAS-luc2
  • Backbone manufacturer
    Liqun Luo
  • Backbone size w/o insert (bp) 2562
  • Total vector size (bp) 4356
  • Vector type
    Mutli-species

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TREtight driven tdTomato fluorescent protein
  • Alt name
    TRE-tdTomato
  • Alt name
    TRE-tdT
  • Insert Size (bp)
    1794
  • Promoter TREtight

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TGCAGGTGCCAGAACATTTCTC
  • 3′ sequencing primer CTGCATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE-tdTomato was a gift from Connie Cepko (Addgene plasmid # 50798 ; http://n2t.net/addgene:50798 ; RRID:Addgene_50798)
  • For your References section:

    A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Tang JC, Szikra T, Kozorovitskiy Y, Teixiera M, Sabatini BL, Roska B, Cepko CL. Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021. 10.1016/j.cell.2013.07.021 PubMed 23953120