-
PurposeExpresses a tandem red ddFP heterodimer in mammalian cells, construct 1 for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid GANLS.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7024
-
Modifications to backboneMulti cloning sites has been replaced by a customized sequence, which is compatible to the reading frame of vector pBAD hisB.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameddRFP A and ddRFP B
-
Alt namedimerization dependent fluorescent protein (ddFP)
-
SpeciesSynthetic; synthetic construct
-
Insert Size (bp)1522
-
GenBank IDKF976779
- Promoter CMV
-
Tags
/ Fusion Proteins
- triplicated NLS sequence DPKKKRKV (C terminal on insert)
- NES sequence LQKKLEELELDE placed after ddGFP A (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site HindIIIt (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NESRA-DEVD-BNLS was a gift from Robert Campbell (Addgene plasmid # 50849 ; http://n2t.net/addgene:50849 ; RRID:Addgene_50849) -
For your References section:
Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange. Ding Y, Li J, Enterina JR, Shen Y, Zhang I, Tewson PH, Mo GC, Zhang J, Quinn AM, Hughes TE, Maysinger D, Alford SC, Zhang Y, Campbell RE. Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261. 10.1038/nmeth.3261 PubMed 25622108