EGFP-IC2-N237
(Plasmid
#51410)
-
Purposeexpression of GFP-tagged N-terminal AA 1-237 of dynein intermediate chain IC2C in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedynein intermediate chain IC2C
-
Alt nameDync1i2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)711
-
MutationAA 1-237
-
Entrez GeneDync1i2 (a.k.a. 3110079H08Rik, AW554389, Dnci, Dncic2)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ACCACCT GACAGATCTCAACCATGTC
- 3′ sequencing primer GATTTAATGAAAGCTTAGCACCTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-IC2-N237 was a gift from Trina Schroer (Addgene plasmid # 51410 ; http://n2t.net/addgene:51410 ; RRID:Addgene_51410) -
For your References section:
Analysis of the dynein-dynactin interaction in vitro and in vivo. King SJ, Brown CL, Maier KC, Quintyne NJ, Schroer TA. Mol Biol Cell. 2003 Dec;14(12):5089-97. Epub 2003 Oct 17. 10.1091/mbc.e03-01-0025 PubMed 14565986