Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pHTN HaloTag CMV-neo/ERGIC2-variant
(Plasmid #51477)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51477 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHTN HaloTag CMV-neo
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6143
  • Total vector size (bp) 7290
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERGIC2
  • Alt name
    PTX1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1147
  • Mutation
    4 base deletion at codon #189
  • Entrez Gene
    ERGIC2 (a.k.a. CDA14, Erv41, PTX1, cd002)
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CCAACCACTGATGATCTGTAC
  • 3′ sequencing primer TCTTATCATGTCTGCTCGAAGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHTN HaloTag CMV-neo/ERGIC2-variant was a gift from Simon Kwok (Addgene plasmid # 51477 ; http://n2t.net/addgene:51477 ; RRID:Addgene_51477)
  • For your References section:

    Characterization of a Variant of ERGIC2 Transcript. Kwok SC, Kumar S, Dai G. DNA Cell Biol. 2013 Dec 4. 10.1089/dna.2013.2225 PubMed 24303950