-
Purpose(Empty Backbone) T-DNA destination plasmid. Contains the bean yellow dwarf virus cis-acting elements (LIR and SIR) in an LIR-SIR-LIR orientation. Contains attR1 and attR2 sites between the LIR and SIR sequence.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAMBIA1300
- Backbone size (bp) 12921
-
Modifications to backboneInserted cis-acting replicational elements from the bean yellow dwarf virus in an LIR-SIR-LIR orientation.
-
Vector typeplant T-DNA plasmid
- Promoter virion-sense LIR and 2x35S
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer atatccagctgaacggtc
- 3′ sequencing primer gtaagtttcacttcacacatt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe sequence for the cis-acting bean yellow dwarf virus replicational elements synthesized on g-Blocks, primers, and long oligos. These elements were fused together before insertion into pCAMBIA1300.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSL was a gift from Daniel Voytas (Addgene plasmid # 51493 ; http://n2t.net/addgene:51493 ; RRID:Addgene_51493) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519