pLSLZ
(Plasmid
#51495)
-
PurposepLSL with Zif268:FokI coding sequence followed by approximately 3kb 'filler' sequence, Rep is not included on this plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAMBIA1300
- Backbone size w/o insert (bp) 12921
- Total vector size (bp) 15619
-
Modifications to backbonecis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
-
Vector typeplant T-DNA plasmid
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameZif268:FokI
-
Speciesfusion between human and bacterial genes
-
Insert Size (bp)897
- Promoter virion-sense LIR and 2x35S
-
Tag
/ Fusion Protein
- SV40 NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer atggcttcctcccctccaaag
- 3′ sequencing primer agctgtcgaggggggatcaa (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name3kb filler sequence
-
Alt nameALS repair template
-
SpeciesN. tabacum
-
Insert Size (bp)3000
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer tgcgagatcgggccggcctg
- 3′ sequencing primer gatattttgaattaaagata (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Zif268:FokI sequence was amplified by PCR using pDW1345. The 3 kb filler sequence was amplified using pZHY455.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSLZ was a gift from Daniel Voytas (Addgene plasmid # 51495 ; http://n2t.net/addgene:51495 ; RRID:Addgene_51495) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519