pCMV-myc-CD4-Sema4D
(Plasmid
#51603)
-
Purposeexpresses Sema4D/CD4 chimera with intracellular Sema4D, extracellular CD4
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCD4-Sema4D
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1700
-
MutationSema4D amino acids 1-754 have been replaced with CD4 amino acids 26-425.
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer gagacacggagagggtcttc
- 3′ sequencing primer TACAACTGCTACAAGGGCTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.
The CD4 insert in this plasmid contains N64I and K385E mutations when compared to GenBank reference sequence NP_038688.2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-myc-CD4-Sema4D was a gift from Suzanne Paradis (Addgene plasmid # 51603 ; http://n2t.net/addgene:51603 ; RRID:Addgene_51603) -
For your References section:
Sema4D localizes to synapses and regulates GABAergic synapse development as a membrane-bound molecule in the mammalian hippocampus. Raissi AJ, Staudenmaier EK, David S, Hu L, Paradis S. Mol Cell Neurosci. 2013 Nov;57:23-32. doi: 10.1016/j.mcn.2013.08.004. Epub 2013 Sep 10. 10.1016/j.mcn.2013.08.004 PubMed 24036351