FRIG-myc-Sema4D-CD4
(Plasmid
#51606)
-
Purposeexpresses myc-tagged Sema4D/CD4 non-cleavable chimera with extracellular Sema4D, intracellular CD4 in lentiviral backbone
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFRIG
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 9200
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSema4D/CD4-FLAG
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)2100
-
MutationSema4D amino acids 660-861 were replaced with CD4 amino acids 378-458.silent mutations between amino acids (approx 275-281) to make resistant against shRNA1. Also silent mutation at aa 54-60 to make susceptible to shRNA2.
-
GenBank IDNM_001281880 NM_000616
-
Entrez GeneSema4d (a.k.a. CD100, Semacl2, Semaj, Semcl2, coll-4)
- Promoter RSV
-
Tags
/ Fusion Proteins
- myc (N terminal on insert)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGTCAAGTTCAGGTGGTCACAGG
- 3′ sequencing primer GCGGAACTCAAATGTTTCCAAAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FRIG-myc-Sema4D-CD4 was a gift from Suzanne Paradis (Addgene plasmid # 51606 ; http://n2t.net/addgene:51606 ; RRID:Addgene_51606) -
For your References section:
Sema4D localizes to synapses and regulates GABAergic synapse development as a membrane-bound molecule in the mammalian hippocampus. Raissi AJ, Staudenmaier EK, David S, Hu L, Paradis S. Mol Cell Neurosci. 2013 Nov;57:23-32. doi: 10.1016/j.mcn.2013.08.004. Epub 2013 Sep 10. 10.1016/j.mcn.2013.08.004 PubMed 24036351