This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

lentiCRISPR - EGFP sgRNA 6
(Plasmid #51765)


Item Catalog # Description Quantity Price (USD)
Plasmid 51765 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    lentiCRISPR (pXPR_001), Addgene plasmid #49535
  • Backbone manufacturer
    Zhang lab
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    S. pyogenes CRISPR-Cas9
  • Species
  • Insert Size (bp)
  • Promoter EFS

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGTACAGTGCAGGGGAAAGA
  • 3′ sequencing primer TGCCCTCCAAATATGTGAACT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Puromycin resistance
  • Alt name
    puromycin N-acetyl-transferase
  • Alt name
  • Insert Size (bp)
  • Promoter EFS

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TGCTGCTACTAAGAAAGCTGGTC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    EGFP sgRNA 6
  • Alt name
    EGFP targeting RNA element #6 (with +85 chimeric RNA)
  • Species
  • Insert Size (bp)
  • Promoter U6

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer #140 hU6-F
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.

Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check for the most up-to-date information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR - EGFP sgRNA 6 was a gift from Feng Zhang (Addgene plasmid # 51765 ; ; RRID:Addgene_51765)
  • For your References section:

    Genome-scale CRISPR-Cas9 knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. 10.1126/science.1247005 PubMed 24336571