pCAH-MIBP16
(Plasmid
#51870)
-
PurposeExpresses C-terminal HA-tagged full length rat MIBP1 (cloned into pCAGGS)
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 12200
-
Modifications to backboneDigested with EcoRI, ligated with an adaptor containing a NotI site and then digested with NotI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMIBP1
-
Alt nameHIVEP2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)7400
-
Entrez GeneHivep2 (a.k.a. MIBP1)
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTG
- 3′ sequencing primer AGGGCATTGGCCACACCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAH-MIBP16 was a gift from Kenshi Hayashi & Tomoko Tahira (Addgene plasmid # 51870 ; http://n2t.net/addgene:51870 ; RRID:Addgene_51870) -
For your References section:
Genome-wide repression of NF-kappaB target genes by transcription factor MIBP1 and its modulation by O-linked beta-N-acetylglucosamine (O-GlcNAc) transferase. Iwashita Y, Fukuchi N, Waki M, Hayashi K, Tahira T. J Biol Chem. 2012 Mar 23;287(13):9887-900. doi: 10.1074/jbc.M111.298521. Epub 2012 Jan 31. 10.1074/jbc.M111.298521 PubMed 22294689