MSCV-shCasp2-IRES-GFP
(Plasmid
#52061)
-
Purposestable knockdown of Caspase-2 in mammalian cells
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV-IRES-GFP-Puro
-
Backbone manufacturerAddgene plasmid #20672
- Backbone size w/o insert (bp) 5900
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCaspase-2 shRNA
-
Alt namecaspase 2, apoptosis-related cysteine peptidase
-
gRNA/shRNA sequenceTGCTGTTGACAGTGAGCGCCCCAACTTCCCTGTTCTTTAATAGTGAAGCCACAGAT GTATTAAAGAACAGGGAAGTTGGGATGCCTACTGCCTCGGA
-
SpeciesH. sapiens (human)
-
Entrez GeneCASP2 (a.k.a. CASP-2, ICH1, MRT80, NEDD-2, NEDD2, PPP1R57)
-
Tag
/ Fusion Protein
- IRES-EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pLXSN5; pBABE5
- 3′ sequencing primer pCDH-rev (GCATTCCTTTGGCGAGAG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-shCasp2-IRES-GFP was a gift from Tyler Jacks & Trudy Oliver (Addgene plasmid # 52061 ; http://n2t.net/addgene:52061 ; RRID:Addgene_52061) -
For your References section:
Caspase-2-mediated cleavage of Mdm2 creates a p53-induced positive feedback loop. Oliver TG, Meylan E, Chang GP, Xue W, Burke JR, Humpton TJ, Hubbard D, Bhutkar A, Jacks T. Mol Cell. 2011 Jul 8;43(1):57-71. doi: 10.1016/j.molcel.2011.06.012. 10.1016/j.molcel.2011.06.012 PubMed 21726810