-
PurposeExpresses GFP-tagged Kif2A in mammalian cells under the CMV promoter
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Total vector size (bp) 6849
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKif2A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2121
-
GenBank IDNM_004520.4
-
Entrez GeneKIF2A (a.k.a. CDCBM3, HK2, KIF2)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer ATTTTATGTTTCAGGTTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-Kif2A was a gift from Gohta Goshima & Ryota Uehara (Addgene plasmid # 52401 ; http://n2t.net/addgene:52401 ; RRID:Addgene_52401) -
For your References section:
Aurora B and Kif2A control microtubule length for assembly of a functional central spindle during anaphase. Uehara R, Tsukada Y, Kamasaki T, Poser I, Yoda K, Gerlich DW, Goshima G. J Cell Biol. 2013 Aug 19;202(4):623-36. doi: 10.1083/jcb.201302123. 10.1083/jcb.201302123 PubMed 23960144