This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #52522)


Item Catalog # Description Quantity Price (USD)
Plasmid 52522 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 10877
  • Total vector size (bp) 15047
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy


  • Gene/Insert name
    S. pyogenes cas9 with humanized codon bias
  • Alt name
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
  • Promoter tubulin
  • Tag / Fusion Protein
    • myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ctcgcacgcagtgccggctcaag
  • 3′ sequencing primer TCGAGGTCGACTCTAGATAAAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRB14 was a gift from Klaus Foerstemann (Addgene plasmid # 52522 ; ; RRID:Addgene_52522)
  • For your References section:

    Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination donors in cultured Drosophila cells. Bottcher R, Hollmann M, Merk K, Nitschko V, Obermaier C, Philippou-Massier J, Wieland I, Gaul U, Forstemann K. Nucleic Acids Res. 2014 Apr 19. 10.1093/nar/gku289 PubMed 24748663