pSIL-eGFP-shACTN3
(Plasmid
#52678)
-
PurposeshRNA against α-actinin-3 with eGFP transfection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52678 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSIL-EGFP
-
Backbone manufacturerHell lab, Addgene plasmid #52675
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameACTN3
-
Alt nameactinin, alpha 3
-
gRNA/shRNA sequenceaacgagaagctgatggaggttcaagagacctccatcagcttctcgtttttttt
-
SpeciesR. norvegicus (rat)
-
Entrez GeneActn3
- Promoter U6
-
Tag
/ Fusion Protein
- CMV-EGFP (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer M13R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
EGFP is a transfection marker, not a fusion.
RNAi targeted at 455–473 from the start sequence of rat α-actinin-3 (the sense chain was 5’-aacgagaagctgatggaggttcaagagacctccatcagcttctcgtttttttt-3’. The 19-nucleotide sense sequence and the inverted antisense sequence were connected by a 9-nucleotide spacer to allow stem-loop formation. At the 3’ end, a penta-thymidine motif provided a polymerase III termination site. siRNAs were cloned into pSilencer™ vector for expression of the respective sequences under the U6 promotor.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIL-eGFP-shACTN3 was a gift from Johannes Hell (Addgene plasmid # 52678 ; http://n2t.net/addgene:52678 ; RRID:Addgene_52678) -
For your References section:
The cytoskeletal protein alpha-actinin regulates acid-sensing ion channel 1a through a C-terminal interaction. Schnizler MK, Schnizler K, Zha XM, Hall DD, Wemmie JA, Hell JW, Welsh MJ. J Biol Chem. 2009 Jan 30;284(5):2697-705. doi: 10.1074/jbc.M805110200. Epub 2008 Nov 21. 10.1074/jbc.M805110200 PubMed 19028690