pBICD2-TUG
(Plasmid #52873)

• Purpose: retroviral expression of TUG
• Depositing Lab: Jonathan Bogan
• Publication: Bogan et al Nature. 2003 Oct 16;425(6959):727-33.

Backbone

• Vector backbone: pBICD2
• Backbone manufacturer: Bogan lab, unpublished
• Backbone size w/o insert (bp): 7233
• Modifications to backbone: pBICD2 is identical to pMX-IRES-CD2 except that point mutations were introduced to eliminate two potential translation start sites 5' of the cloning site.
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TUG
• Species: M. musculus (mouse)
• Insert Size (bp): 1600
• Entrez Gene: Aspscr1 (a.k.a. 1190006K01Rik, ASPC, ASPCR1, ASPL, ASPS, RCC17, TUG)
• Promoter: retrovirus LTR
• Tag / Fusion Protein:
  • IRES-CD2 (mouse) (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: MX1 CCACCGCCCTCAAAGTAGACG
• 3′ sequencing primer: pMI3 CCTAGATGCCATGGCCACTGTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The CD2 transmembrane and extracellular sequence are encoded in the vector, after the IRES, and used for selection in FACS (Liu et al Analytical Biochem 2000, PMID 10805516).