Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pT7-agrBD-I
(Plasmid #53439)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53439 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET101 D-TOPO
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 5753
  • Total vector size (bp) 6460
  • Modifications to backbone
    The agrBD genes of S. aureus RN4220 were cloned into the TOPO cloning site, downstream of the T7-lac promoter
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    T7 Iq Express (BL21 derivative) E. coli is used for expression.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    agrBD locus
  • Species
    S. aureus
  • Insert Size (bp)
    707
  • Mutation
    none
  • Promoter T7-lac
  • Tag / Fusion Protein
    • V5 epitope, 6x HIS (not expressed on agrB or agrD) (C terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer 5' - TAATACGACTCACTATA - 3'
  • 3′ sequencing primer 5' - TAGTTATTGCTCAGCGGTGG - 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NOTE: the tags are not in frame with either insert.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-agrBD-I was a gift from Cynthia Collins (Addgene plasmid # 53439 ; http://n2t.net/addgene:53439 ; RRID:Addgene_53439)
  • For your References section:

    Peptide-based communication system enables Escherichia coli to Bacillus megaterium interspecies signaling. Marchand N, Collins CH. Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5. 10.1002/bit.24975 PubMed 23775238