pT7-agrBD-I
(Plasmid
#53439)
-
PurposeT7-dependent expression of the type-I agrB and agrD genes of S. aureus RN4220
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53439 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET101 D-TOPO
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 5753
- Total vector size (bp) 6460
-
Modifications to backboneThe agrBD genes of S. aureus RN4220 were cloned into the TOPO cloning site, downstream of the T7-lac promoter
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsT7 Iq Express (BL21 derivative) E. coli is used for expression.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameagrBD locus
-
SpeciesS. aureus
-
Insert Size (bp)707
-
Mutationnone
- Promoter T7-lac
-
Tag
/ Fusion Protein
- V5 epitope, 6x HIS (not expressed on agrB or agrD) (C terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer 5' - TAATACGACTCACTATA - 3'
- 3′ sequencing primer 5' - TAGTTATTGCTCAGCGGTGG - 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NOTE: the tags are not in frame with either insert.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-agrBD-I was a gift from Cynthia Collins (Addgene plasmid # 53439 ; http://n2t.net/addgene:53439 ; RRID:Addgene_53439) -
For your References section:
Peptide-based communication system enables Escherichia coli to Bacillus megaterium interspecies signaling. Marchand N, Collins CH. Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5. 10.1002/bit.24975 PubMed 23775238