pT7-agrBD-IV
(Plasmid
#53440)
-
PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53440 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET101 D-TOPO
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 5753
- Total vector size (bp) 6460
-
Modifications to backbonethe agrBD locus (with D29Y mutation in agrD) was cloned downstream of the T7-lac promoter
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsT7 Iq Express (BL21 derivative) E. coli is used for expression.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameagrBD locus (with D29Y mutation in agrD)
-
SpeciesS. aureus
-
Insert Size (bp)727
-
MutationD to Y mutation of residue 29 of the agrD gene (changing the AIP coding from type-I to type-IV
- Promoter T7-lac
-
Tag
/ Fusion Protein
- V5 epitope, 6x HIS (not expressed on agrB or agrD) (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer 5' - TAATACGACTCACTATA - 3'
- 3′ sequencing primer 5' - TAGTTATTGCTCAGCGGTGG - 3' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe agrBD genes in this vector were cloned out of the pT7-agrBD-I vector (with a G to T point mutation, rendering the D29Y mutation in agrD)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NOTE: the tags are not in frame with either gene.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-agrBD-IV was a gift from Cynthia Collins (Addgene plasmid # 53440 ; http://n2t.net/addgene:53440 ; RRID:Addgene_53440) -
For your References section:
Peptide-based communication system enables Escherichia coli to Bacillus megaterium interspecies signaling. Marchand N, Collins CH. Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5. 10.1002/bit.24975 PubMed 23775238