pHB4
(Plasmid
#53462)
-
PurposeThis plasmid contains an ADHpr driven chimeric protein with SNC1, N-terminal GFP and C-terminal SUC2. It contains flanking homology to SUC2, allowing optional integration.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS416
-
Backbone manufacturerSikorski, RS; Hieter, P
- Backbone size w/o insert (bp) 8283
- Total vector size (bp) 10974
-
Vector typeYeast Expression
-
Selectable markersURA3 ; Nourseothricin (ClonNat)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameyeGFP-Snc1-Suc2
-
Alt nameGSS
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2691
- Promoter ADH
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTTCCGGCTCCTATGTTGT
- 3′ sequencing primer GCTGCGCAACTGTTGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Addgene's quality control sequencing has found a few discrepancies with the depositor's full sequence. The depositing lab is aware of these discrepancies, and they are not thought to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHB4 was a gift from Elizabeth Conibear (Addgene plasmid # 53462 ; http://n2t.net/addgene:53462 ; RRID:Addgene_53462) -
For your References section:
Regulators of yeast endocytosis identified by systematic quantitative analysis. Burston HE, Maldonado-Baez L, Davey M, Montpetit B, Schluter C, Wendland B, Conibear E. J Cell Biol. 2009 Jun 15. 185(6):1097-110. 10.1083/jcb.200811116 PubMed 19506040