shRNA Caspase 1 (pSicoR mCherry)
(Plasmid #53575)

• Purpose: shRNA against human pro-caspase 1
• Depositing Lab: Warner Greene
• Publication: Doitsh et al Nature. 2014 Jan 23;505(7484):509-14. doi: 10.1038/nature12940.

Backbone

• Vector backbone: pSicoR EF1a-mCherry
• Backbone manufacturer: pSicoR-Ef1a-mCh was a gift from Bruce Conklin (Addgene plasmid # 31847)
• Backbone size w/o insert (bp): 7484
• Total vector size (bp): 7539
• Modifications to backbone: shRNA Caspase 1 inserted
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: shRNA Caspase 1
• Alt name: shRNA Caspase 1 mCherry
• gRNA/shRNA sequence: acacgtcttgctctcatta
• Species: H. sapiens (human)
• Entrez Gene: CASP1 (a.k.a. ICE, IL1BC, P45)
• Promoter: U6 for shRNA; EF1a for mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hpa1 (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TGCAGGGGAAAGAATAGTAGAC
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • pSicoR EF1a-mCherry backbone sequence
  • shRNA Caspase 1 sequence
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The shRNA was cloned into the HpaI and XhoI restriction sites as described for pSicoR.