pRiboI SapNde
(Plasmid
#54490)
-
Purpose(Empty Backbone) Theophylline-inducible expression in single-copy integrating vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 54490 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMV306
-
Backbone manufacturerW. R. Jacobs
- Backbone size (bp) 4296
-
Modifications to backboneXbaI-NdeI insertion of hsp60 promoter, theophylline riboswitch, and SapI restriction site.
- Promoter hsp60
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsShuttle vector: multi-copy episomal in E. coli, single-copy integrating in mycobacteria.
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCCTTTGAGTGAGCTGATACC
- 3′ sequencing primer CTAGCTGATCACCGCGGCCATGATGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRiboI SapNde was a gift from Jessica Seeliger (Addgene plasmid # 54490 ; http://n2t.net/addgene:54490 ; RRID:Addgene_54490)