-
PurposeCre-on/Flp-on ChR2-EYFP under the short Ef1a promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 55644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 4861
- Total vector size (bp) 6971
-
Vector typeMammalian Expression, AAV ; Cre on/Flp on ChR2-EYFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChR2(H134R)-EYFP
-
SpeciesSynthetic
-
Insert Size (bp)2110
- Promoter nEF
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTTTAAAGCTCAGGTCGAGA
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Resource Information
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-nEF Con/Fon hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 55644 ; http://n2t.net/addgene:55644 ; RRID:Addgene_55644)