pCS5
(Plasmid
#55750)
-
PurposeProduces one half (beta) of aminoglycoside phosphotransferase (3′)-IIa when in the presence of T7 RNA Polymerase.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR322
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 4361
- Total vector size (bp) 4630
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Growth instructionsDeleted AmpR
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKanR
-
Alt nameNeo
-
SpeciesEscherichia coli
-
Insert Size (bp)816
-
MutationResidues 59-264 of KanR
-
GenBank IDNC_012690.1
- Promoter T7-lac
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCGACACGGAAATGTTGAATAC
- 3′ sequencing primer TCACTGATGCCTCCGTGTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySplit protein developed by Dr. Marc Ostermeier.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS5 was a gift from Matthew Bennett (Addgene plasmid # 55750 ; http://n2t.net/addgene:55750 ; RRID:Addgene_55750) -
For your References section:
Stable maintenance of multiple plasmids in E. coli using a single selective marker. Schmidt CM, Shis DL, Nguyen-Huu TD, Bennett MR. ACS Synth Biol. 2012 Oct 19;1(10):445-50. doi: 10.1021/sb3000589. Epub 2012 Sep 4. 10.1021/sb3000589 PubMed 23656183