retro-gfp-puro vector
(Plasmid
#58249)
-
PurposeRetroviral expression vector encoding bicistronic EGFP and Puromycin cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneretro-puro vector
-
Backbone manufacturerStathopoulos Lab (Addgene plasmid #58250)
- Backbone size w/o insert (bp) 6691
- Total vector size (bp) 7432
-
Modifications to backboneBgl II and XhoI digestion
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
SpeciesAequoria victoria
-
Insert Size (bp)747
-
GenBank IDL29345
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGCCCTCACTCCTTCTCTAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The EGFP insert of this plasmid was taken by BamHI and XhoI digestion from a TOPO II plasmid where the EGFP gene (extracted from EGFP-N1) was inserted into the MIGR1 backbone digested by BamHI and XhoI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
retro-gfp-puro vector was a gift from Georgios Stathopoulos (Addgene plasmid # 58249 ; http://n2t.net/addgene:58249 ; RRID:Addgene_58249) -
For your References section:
Mast cells mediate malignant pleural effusion formation. Giannou AD, Marazioti A, Spella M, Kanellakis NI, Apostolopoulou H, Psallidas I, Prijovich ZM, Vreka M, Zazara DE, Lilis I, Papaleonidopoulos V, Kairi CA, Patmanidi AL, Giopanou I, Spiropoulou N, Harokopos V, Aidinis V, Spyratos D, Teliousi S, Papadaki H, Taraviras S, Snyder LA, Eickelberg O, Kardamakis D, Iwakura Y, Feyerabend TB, Rodewald HR, Kalomenidis I, Blackwell TS, Agalioti T, Stathopoulos GT. J Clin Invest. 2015 Jun;125(6):2317-34. doi: 10.1172/JCI79840. Epub 2015 Apr 27. 10.1172/JCI79840 PubMed 25915587