retro-gfp-puro vector
(Plasmid #58249)

• Purpose: Retroviral expression vector encoding bicistronic EGFP and Puromycin cassette
• Depositing Lab: Georgios Stathopoulos
• Publication: Giannou et al J Clin Invest. 2015 Jun;125(6):2317-34. doi: 10.1172/JCI79840. Epub 2015 Apr 27.

Backbone

• Vector backbone: retro-puro vector
• Backbone manufacturer: Stathopoulos Lab (Addgene plasmid #58250)
• Backbone size w/o insert (bp): 6691
• Total vector size (bp): 7432
• Modifications to backbone: Bgl II and XhoI digestion
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Species: Aequoria victoria
• Insert Size (bp): 747
• GenBank ID: L29345

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: AGCCCTCACTCCTTCTCTAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The EGFP insert of this plasmid was taken by BamHI and XhoI digestion from a TOPO II plasmid where the EGFP gene (extracted from EGFP-N1) was inserted into the MIGR1 backbone digested by BamHI and XhoI