Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

retro-gfpIkkb-puro vector
(Plasmid #58251)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58251 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    retro-puro vector
  • Backbone manufacturer
    Stathopoulos Lab (Addgene plasmid #58250)
  • Backbone size w/o insert (bp) 7432
  • Total vector size (bp) 9779
  • Modifications to backbone
    AgeI and HpaI digestion
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ikkβ
  • Alt name
    Ikbkb
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001159774.1
  • Entrez Gene
    Ikbkb (a.k.a. IKK-2, IKK-beta, IKK2, IKK[b], IKKbeta)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer AGCCCTCACTCCTTCTCTAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The EGFP-Ikkb insert of this plasmid was taken by Age I and HpaI digestion from a pEGFP-C1 plasmid

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    retro-gfpIkkb-puro vector was a gift from Georgios Stathopoulos (Addgene plasmid # 58251 ; http://n2t.net/addgene:58251 ; RRID:Addgene_58251)
  • For your References section:

    Mast cells mediate malignant pleural effusion formation. Giannou AD, Marazioti A, Spella M, Kanellakis NI, Apostolopoulou H, Psallidas I, Prijovich ZM, Vreka M, Zazara DE, Lilis I, Papaleonidopoulos V, Kairi CA, Patmanidi AL, Giopanou I, Spiropoulou N, Harokopos V, Aidinis V, Spyratos D, Teliousi S, Papadaki H, Taraviras S, Snyder LA, Eickelberg O, Kardamakis D, Iwakura Y, Feyerabend TB, Rodewald HR, Kalomenidis I, Blackwell TS, Agalioti T, Stathopoulos GT. J Clin Invest. 2015 Jun;125(6):2317-34. doi: 10.1172/JCI79840. Epub 2015 Apr 27. 10.1172/JCI79840 PubMed 25915587