Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

peGFP-XPO5
(Plasmid #58331)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58331 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    peGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Exportin-5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3615
  • Entrez Gene
    XPO5 (a.k.a. exp5)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ATGGCGATGGATCAAGTAAAC
  • 3′ sequencing primer TCAGGGTTCAAAGATGGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    peGFP-XPO5 was a gift from Matthew Wood (Addgene plasmid # 58331 ; http://n2t.net/addgene:58331 ; RRID:Addgene_58331)
  • For your References section:

    Artificial mirtron-mediated gene knockdown: functional DMPK silencing in mammalian cells. Seow Y, Sibley CR, Wood MJ. RNA. 2012 Jul;18(7):1328-37. doi: 10.1261/rna.030601.111. Epub 2012 May 30. 10.1261/rna.030601.111 PubMed 22647847