Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-HA-hIFITM1
(Plasmid #58399)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58399 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-HA
  • Backbone manufacturer
    clontech
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 4211
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFITM1
  • Species
    H. sapiens (human)
  • Entrez Gene
    IFITM1 (a.k.a. 9-27, CD225, DSPA2a, IFI17, LEU13)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-HA-hIFITM1 was a gift from Howard Hang & Jacob Yount (Addgene plasmid # 58399 ; http://n2t.net/addgene:58399 ; RRID:Addgene_58399)
  • For your References section:

    Palmitoylome profiling reveals S-palmitoylation-dependent antiviral activity of IFITM3. Yount JS, Moltedo B, Yang YY, Charron G, Moran TM, Lopez CB, Hang HC. Nat Chem Biol. 2010 Aug;6(8):610-4. doi: 10.1038/nchembio.405. Epub 2010 Jul 4. 10.1038/nchembio.405 PubMed 20601941