pAAV-mCherry-flex-dtA
(Plasmid #58536)

• Purpose: Expresses diphtheria toxin A subunit in Cre positive cells, and mCherry in all the infected cells
• Depositing Lab: Naoshige Uchida
• Publication: Wu et al Nature. 2014 May 15;509(7500):325-30. doi: 10.1038/nature13307.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5604
• Total vector size (bp): 6780
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: dtA
• Alt name: diphtheria toxin A
• Insert Size (bp): 657
• GenBank ID: X00703.1 AB610405.1
• Entrez Gene: DIP_RS18250 (a.k.a. DIP_RS18250, DIP1414)
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: agcaacatagttaagaatac
• 3′ sequencing primer: cgagcttttggagtacgtcg

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry