-
PurposeMESA split-TEV protease chain with Rapamycin FKBP ectodomain, 2 aa scaffold, 6 aa linker domain, N-terminal TEV protease
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 58878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5521
- Total vector size (bp) 6508
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMESA split protease chain with FKBP rapamycin-binding ectodomain and N terminal fragment of TEV protease
-
SpeciesSynthetic
-
Insert Size (bp)987
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATGTGCCGAGCCATCTCTCT
- 3′ sequencing primer ctagctcttagtttggaagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FKBP_SCF2_LD6_NTEV was a gift from Joshua Leonard (Addgene plasmid # 58878 ; http://n2t.net/addgene:58878 ; RRID:Addgene_58878) -
For your References section:
Modular Extracellular Sensor Architecture for Engineering Mammalian Cell-based Devices. Daringer NM, Dudek RM, Schwarz KA, Leonard JN. ACS Synth Biol. 2014 Mar 11. 10.1021/sb400128g PubMed 24611683