pHcRed-miR-125b-1
(Plasmid
#58989)
-
PurposeMSCV based expression vector - co-expresses HcRed and human miR-125b-1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMG
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHcRed fluorescent protein
- Promoter MSCV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer caccctaagcctccgcctcctct (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemiR-125b-1
-
SpeciesH. sapiens (human)
-
Entrez GeneMIR125B1 (a.k.a. MIRN125B1, mir-125b-1)
- Promoter MSCV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer caccctaagcctccgcctcctct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHcRed-miR-125b-1 was a gift from David Baltimore (Addgene plasmid # 58989 ; http://n2t.net/addgene:58989 ; RRID:Addgene_58989) -
For your References section:
Dual mechanisms by which miR-125b represses IRF4 to induce myeloid and B-cell leukemias. So AY, Sookram R, Chaudhuri AA, Minisandram A, Cheng D, Xie C, Lim EL, Flores YG, Jiang S, Kim JT, Keown C, Ramakrishnan P, Baltimore D. Blood. 2014 Aug 28;124(9):1502-12. doi: 10.1182/blood-2014-02-553842. Epub 2014 Jul 8. 10.1182/blood-2014-02-553842 PubMed 25006123
Map uploaded by the depositor.