-
PurposeTALEN designed to target the human AAVS1/PPP1R12C locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTALEN
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 8118
-
Vector typeMammalian Expression, AAV, TALEN
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1-TALEN-L
-
SpeciesSynthetic
-
Insert Size (bp)3012
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3xFlag (N terminal on insert)
- NLS (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCAGTTGCTGAAGATCGCGAAGC
- 3′ sequencing primer TGCCACTCGATGTGATGTCCTC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-TALEN-L was a gift from Danwei Huangfu (Addgene plasmid # 59025 ; http://n2t.net/addgene:59025 ; RRID:Addgene_59025) -
For your References section:
An iCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Gonzalez F, Zhu Z, Shi ZD, Lelli K, Verma N, Li QV, Huangfu D. Cell Stem Cell. 2014 Jun 11. pii: S1934-5909(14)00205-7. doi: 10.1016/j.stem.2014.05.018. 10.1016/j.stem.2014.05.018 PubMed 24931489