Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIND(V5)EcoDam
(Plasmid #59201)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59201 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIND/V5-HisA
  • Backbone manufacturer
    Invitrogen
  • Modifications to backbone
    E. coli Dam added downstream of V5 tag.
  • Vector type
    Mammalian Expression ; DamID
  • Promoter Heat Shock Minimal Promoter
  • Selectable markers
    Neomycin (select with G418)
  • Tags / Fusion Proteins
    • V5 (C terminal on backbone)
    • Dam (DNA adenine methyltransferase) (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer pCasper-hs (GCAACTACTGAAATCTGCCAAG)
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is an expression vector for E.coli Dam, tagged at its N-terminus with a V5 epitope tag. In front of this tag is a small multiple cloning site for the in-frame cloning of your favorite ORF. The Dam part carries its own start codon, so the vector without any additional insert can be used to express Dam only (the absolutely essential control experiment!). In this case Dam is not V5-tagged, because the V5 tag does not have its own start codon. At present we only have a vector for fusing Dam to the C-terminus of your favorite protein. From work in Drosophila we know that Dam doesn’t mind fusions at its other end, but we don’t have a pIND-derived vector for this yet.

DamID in mammalian cells in principle works with transient transfections. However, we found that transient transfections sometimes cause a nasty artefact. For this reason, we strongly recommend that you either use stably transfected cells or lentivirus transduction for DamID.

Expression is driven by an ecdysone-inducible promoter. For DamID we only use the leaky expression from the uninduced promoter. If you want to check the Dam(fusion) protein by Western blotting or immunofluorescence microscopy, expression must be induced by cotransfection of the activator plasmid pVgRXR and treatment with an ecdysone analog such as Ponasterone A (available from Invitrogen). The pIND backbone contains the neomycin selectable marker for making stable cell lines.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIND(V5)EcoDam was a gift from Bas van Steensel (Addgene plasmid # 59201 ; http://n2t.net/addgene:59201 ; RRID:Addgene_59201)
  • For your References section:

    Human heterochromatin proteins form large domains containing KRAB-ZNF genes. Vogel MJ, Guelen L, de Wit E, Peric-Hupkes D, Loden M, Talhout W, Feenstra M, Abbas B, Classen AK, van Steensel B. Genome Res. 2006 Dec;16(12):1493-504. Epub 2006 Oct 12. 10.1101/gr.5391806 PubMed 17038565