pT2SCb
(Plasmid #59385)

• Purpose: Template plasmid for amplification of a selection cassette that includes two transcription terminator elements, an I-SceI site and a modified chloramphenicol resistance gene.
• Depositing Lab: Shelley Copley
• Publication: Kim et al BMC Biotechnol. 2014 Sep 25;14(1):84.

Backbone

• Vector backbone: pHA1887, an 1887 bp fragment extending from bp 690 to bp 2576 of pUC19 (Acc. No. M77789)
• Backbone manufacturer: Copley Lab
• Backbone size w/o insert (bp): 1887
• Total vector size (bp): 2946
• Vector type: template

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Mach1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TT-ISceI-cat2
• Species: Synthetic
• Insert Size (bp): 1059
• Mutation: The 3’-end of the chloramphenicol resistance gene was modified to 5’-AGGAGGTGCATAA to create a sequence resembling the consensus bacterial ribosomal binding site (5’-AGGAGGTAAATAA).
• GenBank ID: KP897157.1

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tatcagggttattgtctcatg
• 3′ sequencing primer: acttgagcgtcgatttttgtg

Resource Information

• Supplemental Documents:
  • GetX python script and documentation

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

iGEM parts BBa_B1002 and BBa_B1006 were used to build the double terminator element. The chloramphenicol resistance gene was taken from pACYC187. The 3'-end was modified from 5'-GGGCGGGGCGTAA to 5'-AGGAGGTGCATAA in order to provide a site resembling the consensus bacterial ribosomal binding site (5'-AGGAGGTAAATAA). We developed GetX (https://sourceforge.net/projects/getx/), a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script.