HA-ISceID44A
(Plasmid
#59424)
-
PurposeExpresses a catalytically inactive form of the endonuclease ISceI
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4822
- Total vector size (bp) 5656
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameendonuclease ISceI mutant
-
Mutationchanged aspartate 44 to alanine (D44A)
-
Entrez GeneI-SceI
-
Tag
/ Fusion Protein
- HA tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGAAAAACATCAAAAAAAACCAGG
- 3′ sequencing primer TTA TTT CAG GAA AGT TTC GGA GGA G (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUsing as template the HA-ISceI plasmid (Rouet et al., Proc. Natl. Acad. Sci. U.S.A. 91, 6064– 6068,1994), a polymerase chain reaction-based strategy was used to construct the mutant form HA-ISceID44A.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA-ISceID44A was a gift from Tom Misteli (Addgene plasmid # 59424 ; http://n2t.net/addgene:59424 ; RRID:Addgene_59424) -
For your References section:
Spatial dynamics of chromosome translocations in living cells. Roukos V, Voss TC, Schmidt CK, Lee S, Wangsa D, Misteli T. Science. 2013 Aug 9;341(6146):660-4. doi: 10.1126/science.1237150. 10.1126/science.1237150 PubMed 23929981