-
PurposepET21-DTag encodes Dead streptavidin (negligible biotin binding) bearing a C-terminal SpyTag, for generation of chimeric SpyAvidin tetramers
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET21a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 5844
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha for propagation of the plasmid. Bl21[DE3] or similar required for protein expression.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDead Streptavidin-SpyTag
-
Alt nameDTag
-
SpeciesE.Coli
-
Insert Size (bp)444
-
MutationThe construct lacks final K of SpyTag
- Promoter T7
-
Tag
/ Fusion Protein
- SpyTag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dead Streptavidin-SpyTag was a gift from Mark Howarth (Addgene plasmid # 59548 ; http://n2t.net/addgene:59548 ; RRID:Addgene_59548) -
For your References section:
SpyAvidin hubs enable precise and ultrastable orthogonal nanoassembly. Fairhead M, Veggiani G, Lever M, Yan J, Mesner D, Robinson CV, Dushek O, van der Merwe PA, Howarth M. J Am Chem Soc. 2014 Sep 3;136(35):12355-63. doi: 10.1021/ja505584f. Epub 2014 Aug 21. 10.1021/ja505584f PubMed 25111182