tol2-GFAP::CD14
(Plasmid #59593)

• Purpose: Magnetic cell sorting of ES cell-derived astrocytes
• Depositing Lab: Ivo Lieberam
• Publication: Bryson et al Science. 2014 Apr 4;344(6179):94-7. doi: 10.1126/science.1248523.

Backbone

• Vector backbone: pUC18
• Modifications to backbone: Human GFAP (gfa2) promoter, follwed by a 5' splice substrate, hCD14 ORF, a bGH poly-adenylation sequence and a FRT-neo-FRT resistance marker. This construct was flaked by tol2L/R recognition sequences.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human CD14
• Species: H. sapiens (human)
• Entrez Gene: CD14
• Promoter: gfa2

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GFAPpro-F ACTCCTTCATAAAGCCCTCG
• 3′ sequencing primer: Neo-R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry