This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pNB784
(Plasmid #60163)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60163 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p406
  • Backbone size w/o insert (bp) 5134
  • Total vector size (bp) 7519
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLuc-yEVenus
  • Alt name
    Firefly luciferase and yeast codon-optimized yellow fluorescent protein fusion
  • Alt name
    p406-SIC1pr-FLuc-yEVenus
  • Species
    Photinus pyralis
  • Insert Size (bp)
    2385
  • Mutation
    FLuc has A4V & S504G (no functional effect)
  • Promoter SIC1pr

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer cactttatgcttccggctcctatgtt
  • 3′ sequencing primer CTGCCGGTAGAGGTGTGGTCAATAAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB784 was a gift from Nicolas Buchler (Addgene plasmid # 60163)
  • For your References section:

    "Measuring fast gene dynamics in single cells with timelapse luminescence microscopy". Mazo-Vargas A, Park H, Aydin M, Buchler NE. Mol Biol Cell. 2014 Sep 17. pii: mbc.E14-07-1187. 10.1091/mbc.E14-07-1187 PubMed 25232010