pRS426-TUB1
(Plasmid
#60385)
-
PurposeExpression of yeast alpha tubulin (TUB1) using a GAL promoter
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60385 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS426
-
Vector typeYeast Expression
-
Selectable markersURA marker for yeast
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTUB1
-
Alt nameYeast alpha Tubulin
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1500
-
Entrez GeneTUB1 (a.k.a. YML085C)
- Promoter GAL
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer aacgtcaaggagaaaaaacc
- 3′ sequencing primer gggagggcgtgaatgtaagc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byContains insert obtained from Luke Rice at UT Southwestern
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Johnson V, Ayaz P, Huddleston P, Rice LM.
Design, overexpression, and purification of polymerization-blocked yeast αβ-tubulin mutants.
Biochemistry. 2011 Oct 11;50(40):8636-44. doi: 10.1021/bi2005174. Epub 2011 Sep 16.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS426-TUB1 was a gift from Ron Vale (Addgene plasmid # 60385 ; http://n2t.net/addgene:60385 ; RRID:Addgene_60385) -
For your References section:
Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327