Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLL7.0: Venus-oLID-Mito (From ActA)
(Plasmid #60414)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60414 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLentiLox7.0
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus-oLID-Mito
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1338
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer CAGCAACCAGGATTTATACAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL7.0: Venus-oLID-Mito (From ActA) was a gift from Brian Kuhlman (Addgene plasmid # 60414 ; http://n2t.net/addgene:60414 ; RRID:Addgene_60414)
  • For your References section:

    Engineering an improved light-induced dimer (iLID) for controlling the localization and activity of signaling proteins. Guntas G, Hallett RA, Zimmerman SP, Williams T, Yumerefendi H, Bear JE, Kuhlman B. Proc Natl Acad Sci U S A. 2015 Jan 6;112(1):112-7. doi: 10.1073/pnas.1417910112. Epub 2014 Dec 22. 10.1073/pnas.1417910112 PubMed 25535392