-
PurposeExpresses MYT1L under the EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneN106
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 8465
- Total vector size (bp) 12020
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYT1L
-
Alt nameNZF1
-
SpeciesH. sapiens (human)
-
GenBank IDNM_015025.2
-
Entrez GeneMYT1L (a.k.a. MRD39, NZF1, ZC2H2C2, ZC2HC4B, myT1-L)
- Promoter EF1a
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
- 3′ sequencing primer GTGGATGTGGAATGTGTGCGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phMYT1L-N106 was a gift from Andrew Yoo (Addgene plasmid # 60861 ; http://n2t.net/addgene:60861 ; RRID:Addgene_60861) -
For your References section:
Generation of Human Striatal Neurons by MicroRNA-Dependent Direct Conversion of Fibroblasts. Victor MB, Richner M, Hermanstyne TO, Ransdell JL, Sobieski C, Deng PY, Klyachko VA, Nerbonne JM, Yoo AS. Neuron. 2014 Oct 22;84(2):311-23. doi: 10.1016/j.neuron.2014.10.016. Epub 2014 Oct 22. 10.1016/j.neuron.2014.10.016 PubMed 25374357