pPL5606_TEF1*-Cre_ADE2
(Plasmid
#60932)
-
PurposeConstitutive expression vector for Cre-recombinase containing ADE2 selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 60932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSH47
-
Vector typeYeast Expression
-
Selectable markersADE2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCre
-
Alt nameCre-recombinase
-
SpeciesE. coli
-
Insert Size (bp)1032
- Promoter mutant TEF1
-
Tag
/ Fusion Protein
- Driven from a mutant TEF1 promoter with 0.16x activity
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer catattttccgtcgatgttgaaatcc
- 3′ sequencing primer cgataccgtcgaggggcagagcc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThey were gene synthesized using a commercial service, which made them according to our design.
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
This plasmid contains I100V, K245R and F258L mutations in the ADE2 gene that do not impact selection or plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPL5606_TEF1*-Cre_ADE2 was a gift from Robert Piper (Addgene plasmid # 60932 ; http://n2t.net/addgene:60932 ; RRID:Addgene_60932) -
For your References section:
Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast. MacDonald C, Piper RC. Yeast. 2015 Feb 16. doi: 10.1002/yea.3069. 10.1002/yea.3069 PubMed 25688547