Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

DR274-eGFP sgRNA
(Plasmid #61051)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61051 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    DR274
  • Backbone manufacturer
    Joung Lab, Addgene plasmid # 42250
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFP sgRNA
  • Species
    Synthetic
  • Promoter T7

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

eGFP sgRNA = GGCGAGGGCGATGCCACCTA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DR274-eGFP sgRNA was a gift from Filippo Del Bene (Addgene plasmid # 61051 ; http://n2t.net/addgene:61051 ; RRID:Addgene_61051)
  • For your References section:

    Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Auer TO, Duroure K, De Cian A, Concordet JP, Del Bene F. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31. 10.1101/gr.161638.113 PubMed 24179142