Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSIN4-EF1a-TAL1-IRES-Puro
(Plasmid #61065)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61065 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSIN4-EF1alpha-IRES-Puro
  • Backbone size w/o insert (bp) 7500
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TAL1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    997
  • GenBank ID
    NM_003189
  • Entrez Gene
    TAL1 (a.k.a. SCL, TCL5, bHLHa17, tal-1)
  • Promoter EF1alpha
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer EF1a-Fwd
  • 3′ sequencing primer pSIN-R: CAAACGCACACCGGCCTTATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIN4-EF1a-TAL1-IRES-Puro was a gift from Igor Slukvin (Addgene plasmid # 61065 ; http://n2t.net/addgene:61065 ; RRID:Addgene_61065)
  • For your References section:

    Direct induction of haematoendothelial programs in human pluripotent stem cells by transcriptional regulators. Elcheva I, Brok-Volchanskaya V, Kumar A, Liu P, Lee JH, Tong L, Vodyanik M, Swanson S, Stewart R, Kyba M, Yakubov E, Cooke J, Thomson JA, Slukvin I. Nat Commun. 2014 Jul 14;5:4372. doi: 10.1038/ncomms5372. 10.1038/ncomms5372 PubMed 25019369